Гены и безопасность

Технология работы с генами подошла к такому рубежу, перед которым соображения об опасности «конвернциональных» ГМО выглядят как детский лепет.

Например, я сейчас занята анализом более чем 50ты тысяч генных последовательностей одновременно. Как это делается. Я выделила из растительных тканей РНК. Это несложно. Затем с помощью фермента обратной транскриптазы я «переписала» их в последовательности ДНК. Это называется кДНК. Это тоже несложно. Затем я отправила их на секвенаторную фирму для прочитки. На выходе я получаю обычный текстовой файл, который простой и незамысловатый. Выглядит вот так ) :

>Ps2001
CTTAATAAAACCCCTCGCGTTGATGAAACTTGAAGGGTAAAAATGAATTAACCCAGGCAA
CTCACCAATATTAGAAGCCTGAGTTGGTGAAAATATTCTACTATACACGTGAGGACAATA
>Ps2002
CCATCTGCCACTCATGTCAATCAGAATCAATTATTAAACCTTACATCCAGTGAAGGGAGG
CGAGAGCCATCTGGAAATTTGTCAACTACCAGCATGACTGATGCTCAAGCTGCAGGGAAG
>Ps2003
ACGGGGAAACGGGACGATTCAGAACTGTGTGACAAAGAGACTCCGAAAGAGTGAAACGGA
AAAATGGGAAGGAAGAAAGGGTAATGTCGAATTCGAGGAATCTCCACCGGACGATTTTGA
TCCGGCGAATCCTTACAAGGATCCGGTGGCTATGTTGGAGATGAGGGAACACATCGTCAG
AGAAAAATGGATCCAAATTGAAAAGGCTAAGATTATTAGGGAAAAGCTTCGTTGGTGTTA
>Ps2004
AATCTTGTTTGAAACAAAAAAGTAATCGCTAAATTCAAAATCAATCTTGTACCAGTACAA
TAAAAAGAACAAAAAATAAAACAAACTGCATAACAAGGTAAAAACAAAATACTCAAACAA
AAAAACAAAACTAAGGAAAAATAGCAACCCACGCCAGAGTTTGCCGGGAATGTAAGTTTT

Я немного пообрезала последовательности для удобства. Обычно они длиннее. Как мы видим, все последовательности разделены тэгами «>» и содержат какое-то условное название: одно название — условно говоря один ген. Как я уже сказала, в файле сейчас около 50 тыщ последовательностей, но сегодняшние возможности позволяют за раз получить пару миллионов. Что мне с ними делать?

Следующий этап работы с этими последовательностями называется сравнительная геномика: надо взять эти последовательности и сравнить с уже известными. Я могу сравнивать как поодиночке, так и все одновременно. Я могу также сравнивать как нуклеотидные последовательности, так и виртуально протранслировать эти последовательности в белок и сравнить с базами данных белков. Это все делается в полностью открытых для всех базах данных и называется это сравнение BLAST (аббревиатура от Basic Local Alignment Search Tool). На лабораторном жаргоне это называется «бластить». Это не просто, это очень просто. Каждый из вас может это сделать и узнать, на какой ген похожа последовательность >Ps2001.

Для этого надо зайти на эту страничку и скопировать в окно последовательность, которую охота пробластить, нажать внизу страницы большую кнопку BLAST и подождать. Можете для интереса попробовать с первой последовательностью и убедиться, что она похожа на некую последовательность из чечевицы. Практически все генные и геномные последовательности хранятся в этой базе данных и каждая из них имеет вот такую учетную карточку, где написано, что это за ген, кем и когда выделен, из какого организма и если известна его функция, то и это тоже указано. Там есть также практически все геномы, которые просеквенированы, а также геномные последовательности вирусов.

Когда я узнала побольше об этой последовательности и она оказалась для меня интересной, я могу выделить ее из генома в целом виде в помощью ПЦР. Это называется клонирование. Теперь эта последовательность у меня в виде материальной молекулы. Если мне лень возиться с клонированием, то я можу отравить последовательность на фирму и они мне насинтезируют. Я также на свое усмотрение могу изменить нативную последовательность, например с целью поизучать эффект от мутации. Вот тут начинается то, ради чего я пишу этот пост.

Сегодня на рынке несколько фирм, предлагающие подобный сервис. Например DNA2.0 в Америке или Geneart в Германии, которые обслуживают всю Европу. Виртуально любой желающий может заказать там молекулу ДНК любого гена на свое усмотрение. И это может быть не добрый растительный ботан с геном гликозил гидролазы, который работает в наглухо зарегулированном научном учреждении, а злодей-биотеррорист с мутантным геном вруса оспы, который в конкурентной гонке за постоянную позицию в университете проиграл, но навыков клонирования не утратил, потому особенно зол.

В общем ситуация ясна и требует назамедлительного решения. Поэтому генные синтезаторы прикинули и решили создать security coalition, которая называется International Gene Synthesis Consortium (IGSC), а также выработать стратегию защиты. Таким образом, скоро лафа для хобби-бластеров закончится. Все заказанные гены на синтез будут проходить обязательную проверку на потенциальную опасность.

Реклама

Добавить комментарий

Заполните поля или щелкните по значку, чтобы оставить свой комментарий:

Логотип WordPress.com

Для комментария используется ваша учётная запись WordPress.com. Выход / Изменить )

Фотография Twitter

Для комментария используется ваша учётная запись Twitter. Выход / Изменить )

Фотография Facebook

Для комментария используется ваша учётная запись Facebook. Выход / Изменить )

Google+ photo

Для комментария используется ваша учётная запись Google+. Выход / Изменить )

Connecting to %s

%d такие блоггеры, как: