Томаты для сердца.

Вчерашние "думающие томаты" многих не оставили равнодушными. Впрочем, в каждой шутке есть доля правды: пурпурные томаты на картинке — генномодифицированные и в них действительно встроены два гена. Но, по-порядку.

Так получилось, что первые трансгенные растения давали преимущества производителю, а не потребителю. В растения обычно встраивались гены устойчивости к вредителями или к гербицидам — упрощая культивирование и расходы на пестициды. Возможно именно это и вызвало недоверие потребителя, во-всяком случае, послужило дополнительным аргументом "против". Кого волнуют проблемы производителей? Некоторые ученые и практики серьезно критикуют такой утилитарный подход, который привел к тому, что такой ценный инструмент, как генетическая модификация, воспринимается в обществе в штыки.

Одним из первых генетически-модифицированных растений, качества которого могли бы быть интересными потребителю, был "золотой рис", сконструированный швейцарцами и немцами в 2000 году. В рис встроили два гена ферментов, которые направляли метаболизм исходного продукта фосфата геранилгеранила по пути синтеза каротина. Несмотря на успех первого поколения золотого риса, он вызвал шквал дискуссий. Во-первых, рис производился в фундаментальной лаборатории, на которую не распространяются "копирайты" технологий. Но, когда рис получился, стало ясно, что он может пригодиться практически. И тогда оказалось, что все материалы, геномные последовательности векторов, с помощью которых производили рис, все запатентованы различными фирмами. Ни один институт не может позволить себе "растаможить" подобный продукт. Попытки решить эти вопросы с участием общественности натыкались на еще большее сопротивление. Рис мог бы быть полезен в странах третьего мира, где печень медведя днем с огнем не сыщешь и есть острый дефицит витамина А в продуктах, но не сложилось. Рис не допущен к культивированию. В 2005 году британцами и американцами создан золотой рис второго поколения, где содержание витамина А увеличено в 23 раза по сравнению с первым. Однако, до сих пор внедрение наталкивается на мощные протесты антиглобалистов. Главный аргумент которых: что ж вы бедных людей кормить рисом хотите, вместо того, чтобы послать печени трески им нормальных витаминов на ваши капиталистические денюжки? Сами ешьте свой рис! (для справки: нормальные витамины продуцируют однако генномодицицированные бактерии).

Пока там с рисом разгребают, продолжаются поиски, чтобы такого можно улучшить, что было бы привлекательным для потребителя. Например увеличить содержание антоцианов в томатах. Антоцианы — пигменты, которые вырабатывают высшие растения, уже давно на хорошем счету у диетологов. С ними связывают полезную сторону употребления крсного вина или средиземноморской диеты. В БАДАх пошли дальше, и торгуют виноградными косточками, сопровождая описанием волшебного действия. Но тут надо оговориться, что антоцианы биологически доступны на 1%, антиоксидативные свойства продемонстрированы только на клеточных линиях и только недавно вышло первое пилотное исследование на крысах. В опыте крысам скармливали антоцианы, а затем провоцировали инсульт. Оказалось, что у крыс, употреблявиших антоцианы, продолжительность жизни после инсульта увеличилась с 140 до 180 дней. Эффект связывают с антиоксидативным действием антоцианов на миокард. Итак, теперь, когда ясно, что антоцианы это хорошо, можно покупать БАДы, а еще лучше, пересмотреть свою диету и купить в супермаркете красный виноградный сок или пурпурные томаты.

Так вот, про томаты. Работа проводилась в Джон Иннес центре в Норвиче, антоцианная аналитика в Германии. Взяли два гена Delila (Del) и Rosea1 (Ros1) из растения львиный зев, вставили под плодспецифичный промотор томата и протрансформировали растения. Получили красивые фиолетовые в крапинку томаты с антоцианами. Томатами покормили мутантную линию мышей, которая склонна к раку и показали, что продолжительность жизни мышей достоверно возросла.

Вопрос: вот вы, как потребители, готовы съесть трансгенный томат, который поспособствует увеличению продолжительности вашей жизни и защитит от болезней?


143 Responses to Томаты для сердца.

  1. главное в продуктах это вкус. если оно такое же «синтетическое говно», которое сейчас продается во всех магазинах, то есть его не хочется.
    ну а цвет мне просто не нравится.

  2. після вчорашнього я вам не вірю!

  3. очень часто синтетическое бесвкусное говно почему-то ассоциируют с ГМО. тем не менее известные ГМО продукты не отличаются по вкусу от натуральных.

  4. я готовий і їм всьо.

  5. з вірою це не до нас. у нас тільки об»єктивні факти!

  6. хочеш довго жити? понімаю!

  7. Если всё по-человечески исследовано и проверено(а на людях как-нибудь проверяют кстати?), то да.
    В дальнейшем так и будет наверно, и жить станем 120 лет за счет «поправок», которые будем потреблять естественным путём.

  8. вкус скорее зависит от технологии и условий выращивания, а не столько от генных модификаций. так что в области портебительских свойств от вас зависит лишь половина или даже меньше.
    я терпеть не могу современные магазинные томаты: их и в салат тошно резать, и так есть, и в блюдо класть. будь они хоть трижды полезными есть их не буду!
    короче как вырастят, так и будут покупать…
    ну и цвет:)

  9. Я вообще спокойно отношусь с ГМ, но если мне обещают, что нечто «поспособствует увеличению продолжительности моей жизни и защитит от болезней», мне бы хотелось знать каков механизм действия. Если это увеличенное количество витамина, который, например, в наших краях (или сезонно) не очень доступен — я готова это есть. Хуже, если обещают какое-нибудь нетривиальное активное воздействие на организм (например, наличие какого-либо компонента вызывает ответ иммунной системы, который защитит меня от болезни). Но это относится не только к ГМ.

  10. и кто ето вас содержать будет до 120 лет?

  11. >> Вопрос: вот вы, как потребители, готовы съесть трансгенный томат, который поспособствует увеличению продолжительности вашей жизни и защитит от болезней?
    Если опустить разные страсти, которые рассказывают про ГМО, то да. Таблетки, в конце концов, тоже не безвредные.

  12. цвет этого томата мне нравится 🙂 еще бы запах и вкус были помидорные, а не пластмассовые, как у того, что в наших магазинах сейчас продается…..

  13. после того, как всю жизнь то и делал, что ел продукты, способствующие уменьшению продолжительности жизни и располагающие к болезни, есть полезные продукты уже как-то боязно. ) хотя стимулятором к принятию решения будут конечно же не вкусовые качества, а то, насколько сильно человек печётся о своём здоровье и конкретная польза.

  14. >ну и цвет:)
    разве что с закрытыми глазами есть

  15. что касается вкуса — понимаю.

  16. ага. то есть правы те, кто говорил, что ГМО — технологии надо быть ближе к человеку и его потребностям.

  17. а нельзя ли его каким-нибудь «геном» подкрасить во что-нибудь более жизнеутверждающее:)

  18. вот вы, как потребители, готовы съесть трансгенный томат, который поспособствует увеличению продолжительности вашей жизни и защитит от болезней? — у меня нету комплексов по этому поводу. Буду кушать без особых раздумий.

  19. ГМО не медицинский препарат, чтобы его проверять по тем же критериям. Хотя критерии допуска жестче, чем для обычных сортов. Например, их дополнительно проверяют на потенциальную аллергенность.

  20. наверное можно, но пока не насобиралась критическая масса возмущенных потребителей

  21. похоже, вменяемых людей больше, чем кажется на первый взгляд

  22. dgri:

    Чтобы широкие народные массы приняли идею, нужно начать с трансгенной водки.

  23. про конкретную пользу и заботу о здоровье — справедливо

  24. Я готов есть любые ГМО-продукты, даже те, которые удобны только производителю 🙂
    Впрочем, сейчас я даже не знаю, ем я ГМО или нет, потому что когда что-то покупаю — совершенно не интересуюсь его генетическим статусом. Если же ГМО будут обладать ярко выраженными полезными качествами, то, скорее всего, буду специально выбирать именно их.

  25. если учитывать, что вообще все овощи-фрукты так или иначе генномодифицированы, то мне лично все равно 🙂 я бы ел.

  26. а давайте томаты отдельно, а львиный зев с антоцианами — отдельно 🙂

  27. можно. Но львиный зев кроме антоцианов содержит сапонины и гликозиды (раздражение желудочно-кишечного тракта, нарушение сердечной деятельности)

  28. Я как потребитель готов съесть любой томат, был бы вкусный и не ядовитый. В увеличение продолжительности жизни с его помощью я особо не верю, в уменьшение, впрочем, тоже.

  29. ну есть под генной модификацией считать и селекцию, то да.

  30. Так, что значит не верю?!! Крысы ели и жили, а ты чем хуже?

  31. думаю, что сначала будет трансгенное пиво. сейчас все силы брошены на поиск генов молтинга у ячменя.

  32. понятно. вижу, что то ли у меня читатели специфические, то ли пугливые на ГМО не коментируют.

  33. а мы их солями калия и магния

  34. dgri:

    Тоже хорошо.
    А к трансгенному пиву — трансгенную воблу и прочую закусь.
    Томаты и пр. ел бы без проблем.

  35. Зачем меня содержать?
    Я надеюсь, что соответственно все сроки «подвинутся».

  36. я работала рядом с лабой, которая модифицировала дрожжи по заказу бельгийцев — чтобы этанолу побольше, а метанолу поменьше 🙂 это было ну очень давно, так что пиво у нас давным-давно ГМО 🙂

  37. Ну дык,,, ферменты всяческие :))
    А вообще за ГМО да.

  38. Не уверено, что правильно понял что вы имеете ввиду. Я думаю, что ждать миллион лет эволюции, пока природа создаст что-то с нужными нам свойствами, не интересно, так как умрем мы раньше. Непривычный цвет — вопрос именно привычки. Если полезно, почему бы не есть? Если есть объективные причины вреда (ну в самом деле, не враг же я сам себе), то есть не буду, конечно.
    Если вопрос касается «рекламы», ну типа толщины дисплея или количества мегапиксилей. То если оно стоит денег заплачу, если не стоит, то и не заплачу. Сложно оценить сколько я готов заплатить за ту или иную мульку.

  39. Легко! только я цвет этот не люблю 🙂

  40. Вы все правильно говорите!

  41. Carlsberg принципиально не использует ГМО. Все свои штаммы они получают селекцией. Это, очевидно, входит в цену 🙂

  42. ну видите ли, вам уже к 50-60 надоест работать, к 80 вы будете богатым человеком и уж точно перестанете работать, а вас придется обслуживать, выращивать для вас продукты и т.д. и т.п. И таких как вы при 120-летней жизни будет ооочень много. с каждым годом все больше и больше. а процент работающих будет постоянно уменьшаться.
    не загонять же почетных 100-летних пенсионеров в трудовые лагеря.

  43. хехе, как бы их еще научить менее крепкое гнать и менее противное.

  44. хехе!!! може дріжджів ГМО і не використовують, а от лабу генних інженерів ячменю все ж набрали.

  45. Готов — но цвет уж очень какой-то непривычный. Странно будет.

  46. Очевидно, спам наступних десятиліть пропонуватиме помідори для пеніс енларджмент.

  47. зачем есть ГМО если есть красное вино :).
    А по поводу невкусных помилоров — какой покупатель такие и помидоры :). Сейчас в продаже осталось только 1-2 хорошо хранящихся «пластмассовых» сорта. Из за того что реальную цену вкусных скоропортящихся помидоров народ платить не готов.

  48. Гыгыг :))) а как гордились, как гордились :)))
    Ну, с другой стороны — хотя бы ячменя… Чехи рассказывали, что традиционное пиво получить в промышленных масштабах решительно невозможно, поэтому технологя совершенно другая, но это еще ладно… однако пиво из ячменя сейчас на больших заводах практически не делают: дрожжи кормят чем угодно подешевле, вроде кукурузы или крахмала, а потом только добавляют солодовый экстракт для привкуса 🙂

  49. фиг знает… будет вкусным — съем

  50. мне, как потребителю, хватает даже того, что г.м. растения не требуют обработки пестицидами
    а уж это — просто роскошно
    салат будет выглядеть сногсшибательно
    ДАЁШЬ ГМО!!!

  51. Гмм.. Если не ошибаюсь раньше жили меньше чем сейчас. Они тоже могли так рассуждать, однако ж.
    >> к 50-60 надоест работать, к 80 вы будете богатым человеком
    Ну а это уж совсем вилами на воде 🙂

  52. раньше не столько меньше жили, сколько умирали слишком рано. статистика штука обманчивая.
    вилами, не вилами, а вы сначала доживите.

  53. Не готова. К ГМО отношусь с недоверием, просто из-за недостаточной изучености последствий и их «необратимости». А вот цвет меня не смущает — такие помидоры и селекцией получаются.

  54. Интересно, многие ли противники ГМО из принципа не будут понижать вероятность возникновения у себя рака?

  55. О, нормально. А интернетом вы пользоваться не боитесь? Ведь влияние компьютеров на человека изучают гораздо меньшее время, чем генно-модифицированных продуктов.

  56. Комп и человек — это отдельная история, не надо все в кучу. Но прекратить выпуск компьютеров проще, чем остановить распространение генномодифицированных растений.

  57. Ну вот из принципа протестуют же против каротинового риса. Сами есть не будем и другим не дадим.

  58. мне муж-врач систематически рассказывает: приходит больной с начальной стадией рака, получают лечение, но вместо явки в соответствующие инстанции бежит к многочисленным и разнообразным бабкам от гомеопатии до иглоукалывания. Возвращаются когда ничего уже сделать нельзя и метастазы по всему организму. Так что увы 😦

  59. Насколько я понимаю: основная проблема выращивания ГМО растений — их перекрестное опыление с не ГМО культурами. Т.е. один раз начав — уже не остановишь.

  60. Это не есть основная проблема.
    Во-первых, соя, например, самоопылитель. И это растение, которые вызывает кучу возражений у потребителей.
    Во-вторых, есть возможность встроить генетическую стерильность пыльцы. Это вызывает еще большее возражение у противников, дескать на этом будут наживаться компании-производители (хто это говорят те, кто не имеет ни малейшего представления об особенностях сельского хозяйства). Я даже встречала предположение, что эта стерильная пыльца все переопылит и все вокруг станет стерильным, но это уже за гранью здравого смысла.
    И наконец, а какую вообще опасность таит в себе переопыление?

  61. салатик из них прикольно выглядеть будет 🙂
    конечно, буду, что за вопрос 🙂

  62. > И наконец, а какую вообще опасность таит в себе переопыление?
    Био-фермеры на соседних полях просто не смогут получить свою «био»-сертификацию.
    Например, от знакомого булочника узнал недавно что для того чтобы получить право лепить «био» хлеб нужно помимо сертифицированного сырья использовать выделенное только для него оборудование — мешалку, печь и тп. Просто такие правила.

  63. Цвет устраивает, антоцианы тоже. Побочки бы еще получше изучить, скажем, на старых-престарых обезьянах, и вперед, к потребителю, то есть, ко мне!

  64. А мне кажется — классный цвет! Интересненькие такие салаты будут получаться 🙂

  65. Да? Правда? Вы представляете себе продуктивность сельского хозяйства, работающего с предковыми (без генных модификаций) культурами растений и видами животных? Ну, там, с пшеницей-двузернянкой и диким муфлоном, скажем?

  66. Пользуясь этой логикой, производство электролампочек надо было запретить, чтобы не подорвать бизнес владельцев свечных заводов.

  67. Хорошо представляю 🙂 А вы представляете себе, что во Франции ГМО до последнего момента были запрещены? И страна при этом не умерла с голода и даже торговала сельскохозяйственной продукцией?
    И не подменивайте понятия, селекция — не генная инженерия. Разницу знаете, надеюсь.

  68. Без проблем. Лишь бы вкусные были :). Если серьезно, то я не подвержена антиГМО-истерии, поскольку а)технарь, б)химик. На эмоции про бедных крысок, накормленных соей, не ведусь.

  69. Основная проблема, что последствия не изучены, в первую очередь для окружающей среды. L’effet papillon 🙂 Во Франции последний запрет ГМО был связан с тем, что они угрожали ореолу обитания редкой бабочки. Ну а в сочетании с их некотролироемостью есть риск экологической катастрофы.

  70. Не знаю разницу. Объясните дураку. Чем отличается в смысле результата изменение генотипа путём многолетнего отбора случайных мутаций, от управляемого производства тех же самых мутаций в тех же самых генах?
    Это, кстати, поможет ответить на вопрос, «почему не умерла Франция».

  71. Ага. А компьютеры потенциально могут угрожать комарам редких видов: вентиляторы ж их засасывает!
    Скажите, разве непонятно, что ВСЕ последствия любого изобретения можно изучить только за время, равное жизни вселенной? А если это так — что, запретить технический прогресс?

  72. Слушайте, если вы хотите меня в чем-то убедить, то перестаньте говорить лозунгами. При чем тут комары и компьютеры? У вас есть факты? Без фактов это чистая демагогия.
    Если же вы желаете помитинговать, то это не ко мне, пожалуйста.

  73. Разница в введении чуждого гена. Изначально в организме не существующего.
    И вообще, был вопрос «кто хочет есть OGM, кто не хочет». Я не хочу. Вам это создает проблемы? Чего вы митингуете?

  74. Да, «у меня есть факты». А именно: генно-модифицированные продукты спасают от голода миллионы людей.
    Пожалуйста, приведите какие-нибудь факты их опасности. Только не слова вроде «последствия не изучены», а конкретные факты конкретного вреда. Желательно, перевешивающего пользу от спасения людей от голода.

  75. Так ведь люди наши — в массе своей идиоты. Неужели это сюрприз для вас, и особенно для вашего мужа-врача?

  76. Отлично. Итак, если ген делают «чужим» за счёт замены нескольких нуклеотидов направленным воздействием, а до этого — делали «чужим», дожидаясь, пока эти же самые нуклеотиды заменятся на другие случайно — в чём разница между этими «чужими» генами, кроме времени, затраченного на их производство?
    Я митингую, потому что мне трудно мириться с глупостью людей, прикрывающихся глупыми аргументами. Впрочем, чем дальше, тем это делать становится легче. В этом плане Ницше с его «падающего — толкни» очень мозги прочищает.

  77. Хорошо, дайте пару фактов, мои лозунги опровергающих.

  78. Нет, просто нельзя принудительно загонять людей в «щастье» — чем хотят тем пусть и освещаются.
    Высадив ГМ кукурузу на соседнем поле вы не оставите выбора окружающим.
    ЗЫ: я не фанат «био»-еды. Просто транслирую аргументы тут циркулирующие.

  79. Я, будучи неученым пахарем и огородарем, обожаю помидоры под названием Здоровый Пинок. Вот что про них написано: «It is bred to have have 50% more lycopene than the average tomato. Lycopene is considered to be one of the best antioxidants available.» Значит ли это, что они трансгенные? Не дай пропасть, я их уже 3-й год сажаю и ем, и ем, и ем!

  80. где купить?! идеально чтоб рассада продавалась на рынке

  81. смотря где. в Германии по закону в пиве может быть только солод, хмель, дрожжи и вода. все остальное банально не имеет права продаваться под названием «пиво». я не против кукурузы, да и бельгийское пиво мне больше нравится, но увы…

  82. В общем, как и следовало ожидать, принципиальные противники ГМО вас не читают — ан масс, как говорится. Видимо, руководствуясь теми же принципами.

  83. если так рассуждать, легче поселиться отшельником чем жить в этом обществе идиотов

  84. Здесь сказано что сие есть гибрид. Как он получен, перекрестным опылением (обычная практика выведения новых сортов) или слиянием ядер (в принципе то же самое, но подпадает под определение ГМ), не написано.

  85. больше ГМО!
    интересно читать комментарии. на пластмассовость вкуса магазинных помидоров вот жалуются — вот где надо развернуться компаниям! помидоры со вкусом яблок или что-нибудь в этом роде. или вообще фантастические фрукты, тысячи новых вкусов и цветов.
    конечно у тебя подобрались вполне определенные читатели; массы все равно будут потреблять подозрительные антоцианы и прочие чеснок форте не вспоминая про «недостаточную изученность их последствий».
    про ГМО из вчерашнего Шпигеля:

  86. Послідовний протівнік ГМО должен буть веганом і їсти тіки вирощене своїми руками. А то мясо, яйця сири їдять з гормонами і антибіотиками, овочі з гербіцидами і пестицидами, ковбасу з вопще страшно сказать шо там, — всі ці добавки і довєски до їжі мають научні докази шкоди для здоровя, — і нічо, їдять, аж гай шумить. А ГМО, шо не має доказів шкоди покашо, їсти не хотять.
    Давайте, я здім.

  87. У меня нет страха перед ГМО как таковым.
    Просто из информационного потока я уловила, что много ГМО-продуктов… ну, не доработаны. Т.е. помимо полезных свойств имеются и побочки.
    Опыт с соей на крысках и все такое… Все-таки есть здравые мысли по поводу — если растение устойчиво к яду, которым поливают грядки, чтоб сорняки сдохли, это не значит, что но этот яд не набирает в себя.
    Вообще буду, наверное. Стока дряни ем и пью, начиная с раствора ортофосфорной кислоты, чего уж тут, вдруг и впрямь полезное…

  88. А кто вам денюжки будет приносить? 🙂

  89. денюжки я и сама заработаю, а подход «все вокруг идиоты» для меня неприемлем

  90. Ну если вы поселитесь отшельником, вероятно, ваш быт будет несколько скуднее, чем тот, к которому вы привыкли. Поэтому, даже если человек считает всех вокруг идиотами, это вовсе не значит, что рядом с ними жить невозможно и вовсе не обязательно куда-то переселяться, это уж крайняя — крайняя мера.

  91. Удивительное дело…
    Ссылка на Nature ведет к полному тексту — но для неподписчиков полный текст недоступен, можно попросить ссылку на абстракт про помидоры и больных мышек?
    Я недавно возилась с геном топоизомеразы, и мне попадались статьи на тему того, что флавоноиды ингибируют топоизомеразу, а при этом клетки трансформируются. Сейчас найду… вот, нашла: раз, два.
    В ретроспективном исследовании на людях вроде бы нету строгих доказательств, но все-таки подозревают употребление флавоноидов (и антоцианов, значит) в повышении риска возникновения острой миелобластозной лейкемии у детей… А на клет.культурах видно, что таки да, флавоноиды вызывают трансформацию гемопоэтических стволовых клеток.

  92. оффтоп
    вот посмотри — ответ наших академиков (в лучшем смысле этого слова) http://www.novayagazeta.ru/data/2009/033/25.html на статью Анохина. Я рада, что они отреагировали.

  93. читайте ветку внимательно: я не считаю окружающих идиотами, поэтому мне отшельничество не светит. К сожалению, мне приходится контактировать с подобными личностями «высшего порядка», очень неприятно, да и им живется несладко — жить среди быдла крайне тяжело.

  94. а как же сорта черный принц, цыган, мавр? многим наоборот необычный цвет нравится 🙂

  95. у меня как у вегетарианки вся надежда на гмо. чтоб в помидорах например увеличили содержание B12, не нужно было бы витамины пить 🙂

  96. давай мейл, я вышлю пдф. комент с мейлом заскринирую.

  97. Re: оффтоп
    это хорошо, что отреагировали. хотя все-равно вяло, как для такого масштаба.

  98. Да я внимательно читал. Он живет с «идиотами» и не тужит, а вы предлагаете ему поселиться отшельником. Я говорю, что от этого ему будет хуже и легче смириться с идиотами вокруг или даже зарабатывать на них, нет никакого смысла куда-то переселяться 🙂

  99. Спасибо за статью! ГМ продукты — это однозначно хорошо. Жаль, что так много профанских спекуляций на эту тему…

  100. против трансгенного томата ничего не имею, но вот цвет их мне как-то не очень нравится, чисто эстетически. Иээх, консерватор я 🙂

  101. Я прошу прощения если вдруг кого-то повторю сейчас, ибо читать все комменты не стала, а то мысль потеряю.
    Я собсно вот о чем: Вы все так красивенько описываете: вырезали ген, вставили ген… И тихонько так опускаете информацию КТО там у этих томатов вектором служит для вырезания и встраивания? И насколько томаты застрахованы от того что этот вектор не принесет чего-то «левого» в их геном?
    Прошу сильно не злиться, сейчас это очень спорный вопрос и его уже обсосоали как могли, но он остается открытым.
    Не серчайте :))
    Я не против ГМО, я за их детальное изучение перед тем как выпускать их на растерзание потребителей.
    (Тем более, что большинство витаминов и прочих лекарственных препаратов уже давно получаются благодаря ГМО микроорганизмам)

  102. Как это тихонько выпускаю? Я даже картинку вектора дала! Встраивается то, что между RB LB. Остальное не встраивается. А что такого может привнести именно этот вектор левого в геном? Где обсасывают? дайте ссылку.

  103. Ладно, хотела деликатно обойти, но раз уж на то пошло.. 🙂
    Я хотела узнать что именно используется в качестве вектора: вирусы или плазмиды (или еще какое-то ноу-хау).
    А акцентировать не хотела потому как многие при упоминании о вирусах, использующихся для генетических модификаций, приходят в жуткую истерику и называют меня параноидальной выдумщицой (или что-то типа того). Поэтому в кругах, где я толкаю подобные речи, я о вирусах больше не заикаюсь 🙂
    Я ведь вот о чем: проблема в том, что вирусы — штука плохо изученная. Сейчас даже несчастные бактериофаги, которые применяют для лечения различных инфекционных заболеваний, уже назначают с опаской и в крайних случаях.
    Не знаю, является ли известным Вам тот факт, что геном человека (по утверждению некоторых авторитетных для меня лиц, но неизвестных Вам) на 30% состоит из вирусной ДНК (это последствие вирусных заболеваний человечества), то есть отметать тот факт, что вирусная ДНК так или иначе может встроится в геном человека, отметать полностью нельзя.
    Насколько помню, в генной инженерии используются сейчас такие консервативные последовательности, как ТТГАЦА и ТАТААТ, и думаю это не будет для Вас чем-то новым. Они (вот тут извините, могу ошибаться) инициируют репликацию генов, расположенных далее по цепи.
    И вот тут начинается самое интересное и надуманное: если вдруг случайно эти последовательности встраиваются в человеческий геном (в ген, который, предположим, был закрыт для репликации ввиду имеющихся там нехороших мутаций непосредственно перед репрессором). В таком случае происходит репликация этого гена. В худшем случае это вызовет пролиферацию с образованием опухолей. Чаще всего — в кишечнике.
    Настоятельно прошу не убивать меня за этот пост :))

  104. ну зачем же сразу убивать. Для того и пишу, чтобы поговорить.
    Растения обычно трансформируют не вирусными векторами.
    Что касается вирусов, так исследования Крейга Вентера показали, что в чайной ложке морской воды содержится сотни вирусов и уже вероятность, что там есть ТТГАЦА и ТАТААТ куда больше. Опять таки, в той пище, которую мы употребляем, ДНК с такими гексамерами просто ужасающая.
    Опять таки, проблема ракообразования не столько в наличии нехороших мутаций провоцирующих пролиферации, а скорее в сбое в иммунной системе, которая это распознает и убивает. Не секрет, что у нас постоянно образуются в организме потенциальные раковые клетки, которые вовремя распознаются и элиминируются.

  105. Ну да, согласна, проблема слегка надумана, однако и отказываться от нее полностью не стоит.
    Да, огромную роль в образовании раковых опухолей играют сбои в иммунной системе, а если учитывать, что по вине тех или иных факторов иммунный статус человека в наше время оставляет желать лучшего — куча аллергий, хронические заболевания, иммунодефициты (как приобретенные, так и врожденные) и просто подавление нормальной работы иммунной системы. Это еще один фактор риска не только спонтанного опухолеобразования, но и индуцированного чем-либо, в том числе и ГМО.
    Насчет вирусов, то да — каждый из тех, что обладают ДНК-геномом и встраиваются в процессе своег оразмножения в ДНК человека, могут забрать в итоге часть человеческой ДНК и оставить часть «своей». И да, очень большой процент таких ракировок приходится на «молчаливую» ДНК или же элиминируется своевременно иммунной системой, однако вот пример из жизни:
    Такие вирусы как ВПГ (вирус простого герпеса), вирус гепатитов В, С в процессе жизнедеятельности встраиваются в ДНК человека и исключить их оттуда практически невозможно, ибо никто точно не знает куда именно он встроится в той или иной клетке. Поэтому эти заболевания излечить пока невозможно.
    О чем это я? А! Не смотря на все положительные факты и кричащую выгоду производства и потребления ГМО, я бы настоятельно рекомендовала товарищам ученым либо синтезировать абсолютно «безвредные векторы», либо очень плотно занятся изучением вирусов и последствий их обитания в организме человека.
    Кстати «имя» вектора для ГМ-растений так и осталось для меня неизвестным 🙂

  106. 1. Знаете какова вероятность встраивания канамицинустойчивости (которая там есть в векторе в готовом виде вместе с сайтами рекомбинации) из скажем растительных отходов на полях в геном почвенных бактерий (что легко делается даже замораживанием оттаиванием?). Это посчитали. 1: 100 000 000 000 000.
    2. Прикиньте теперь вероятность встраивания последовательности ТТГАЦА и ТАТААТ, которая совершенно точно есть не только в ГМО, а в любой пище, а доля этой последовательность в ГМО шесть нуклеотидов на весь геном случайно в одну из клеток кишечника как раз на нужном месте и чтобы при этом еще и это не распозналось имунной системой. Я вам скажу, что это риск будет в кубе ниже, чем у бактерий. Не существует ни одной возможности вообще это показать на практике. Это надо все человечество лет сто кормить только одними трансгенными томатами. И то не факт, что мы поймаем этот один уникальный случай.

  107. вектор
    Plasmid construction
    The 2175bp E8 promoter was amplified from tomato genomic DNA by PCR with the following primers: E8FK, 5’-GGGGTACCCATCCCTAATGATATTGTTCACG TAA-3’ and E8RB 5’-CGGGGATCCGCACTGTGAATGATTAGAATAATTTCT-3’. The promoter was cloned in pJIT60 to replace the CaMV 35S promoter and in pJAM1500, (pJIT60 containing a Gateway Destination Cassette; Invitrogen) such that E8 replaced the 35S promoter. This resulted in plasmids pE8.60 and pE8.1500 respectively. The region containing E8-Gateway-CaMVTerminator from pE8.1500 was cloned in pSLJ7291 resulting in plasmid pSLJ.E8.1500. The full-length Delila cDNA was amplified by PCR using primers: DELF, 5’ GGGGA CAAGTTTGTACAAAAAAGCAGGCTACCATGGCTACTGGTATCCAAAAC CAAAAG-3’ and DELR, 5’ GGGGACCACTTTGTACAAGAAAGCTGGGTGG ATCCAACTTCAAGACTTCATAGTAACTTTCTG-3’ inserted in this plasmid using Gateway recombination technology, resulting in the binary construct pSLJ.E8.DEL. The full-length Rosea1 cDNA was amplified with the following primers: ROSF, 5’-CGGGGATCCATGGAAAAGAATTGTCGT-GGAGT-3’ and ROSR, 5’-TCCCC CGGGTTAATTTCCAATTTGTTGGGCCT-3’ and inserted in the plasmid pE8.60, resulting in plasmid pE8.ROS. After the introduction of a double stranded oligonucleotide containing a SalI restriction site in this plasmid, the region containing E8-Rosea1 cDNA-CaMVTerminator was cloned as a SalI-XhoI fragment in the XhoI site of pSLJ.E8.DEL resulting in the binary construct pDEL.ROS.

  108. Re: вектор
    Охренеть :))

  109. Ладно, ляпну уж чтобы ляпнуть 🙂
    Короче мы хаваем ГМО по принципу «меня это не зацепит уж точно: видали какая вероятность-то!»
    Не принимайте близко к сердцу 🙂

  110. Так мы все на самом деле так хаваем. Нет ни одной технологии с нулевым риском. Захлебнуться можно и стаканом воды и вилкой подавиться. Учитывая, как часто пьют воду из стакана и как неаккуратно орудуют вилкой, вероятность гораздо больше чем зацепиться ГМО. Единственное, что мы можем сделать — это оценить риск и включить здравый рассудок. Пока он говорит нам, что ГМО одна из самых безопасных технологий, если ее не использовать сознательно во вред.

  111. Чтобы спокойно етсь то, что производят руки человеческие, нужно как раз отключить (на всякий случай) и здравый смысл и логику 🙂
    Тогда и жить дольше будем (по принципу «меньше знаешь — крепче спишь») и нервами меньше страдать 🙂

  112. Вот это меня и интересует, ибо информации не могу найти.

  113. Вот сюда можно: cloning (кружок) мейл ру
    У нас на работе подписка на журналы кончилась, а я сейчас в декрете; а кроме меня никто это дело не продавит, увы. 🙂 Надо бы восстановить подписку; но начальство хочет по безналу это сделать, а я не нашла пока такой способ, как бы по безналу подписаться на журналы от имени фирмы, а не от частного лица…

  114. > купить в супермаркете красный виноградный сок
    Я с год как «подсел» на указанный сок ничего не зная об антоцианах, просто чувствую полезность. Ан вон оно как …

  115. Анонімний:

    Вставлю 5 копеек.
    Риск сгореть заживо в вагоне метро — больше. Но Вы-же в метро ездите 🙂

  116. Re: Вставлю 5 копеек.
    Не езжу. Извините…

  117. Анонімний:

    Re: Вставлю 5 копеек.
    Ладно, я привел этот пример, как один из наиболее брутальных в области транспорта 🙂
    Если серьезно, то вокруг нас огромное количество технологий, уже являющихся неотъемлемой частью нашей жизни, которые периодически выходят из-под контроля сокращают размер нашей популяции. Правда, несущественно.

  118. Re: Вставлю 5 копеек.
    я тож так думаю, ну налетит (это я не про ГМО а как наиболее брутальный пример) какая-нить очередная жутко агрессивная ядреная болячка, ну полягут наконец все китайцы, это все не существенно, нам-то легче станет.
    Я согласна, нужно сократить численность населения 🙂

  119. Анонімний:

    Re: Вставлю 5 копеек.
    Реакция на свиной грип (скорость реакции научного и медицинского сообщества, глобальная оповещенность гос. структур, контроль распространения, etc) говорит о том, что если не произойдет резкого падения технологического уровня, то глобальные пандемии смертельных болезней, способных существенно сократить нашу популяцию, человечеству уже не грозят.
    Также, я все-таки надеюсь, что численность народонаселения мы будем сокращать сами старым добрым способом: войной. Она как-то ближе и понятнее. Болезни — это неприятно.

  120. Re: Вставлю 5 копеек.
    да ладно, опасность «свинного» гриппа попросту раздута (не буду обьяснять с чего это я решила и зачем вообще раздули).
    И да, войны таки намного приятней чем болезни. 🙂
    Хотя я б таки подсыпала кой-кому какой-нить заразы в мороженное, дабы некто скончалася (пардон) на фарфоровом друге от обезвоживания 🙂
    Предлагаю нанять самолет и распылять споры сибирки над местами скопления неприятных личностей.
    Не симя умолкаю, а то прийдут и повяжут за хранение опасных микробств… 🙂

  121. Вы лучше скажите, где таких семян взять. Это же бомба! ,) Не дают поди всем подряд?

  122. с удовольствием бы покупал и регулярно.
    я вообще стараюсь покупать именно гмо-продукты. модификации же вносят из рациональных соображений: улучшение потребительских качеств или снижение себестоимости. зачем себя обижать?
    а тут и цвет неплохой.

  123. Анонімний:

    а как ваши дети борются с аллергией?
    А внуки?
    И со здоровьем все хорошо?

  124. Дураки они, что ли?
    В документе AAEM далее говорится, что «несколько исследований на животных свидетельствуют о серьезных рисках для здоровья, связанных с ГМ продуктами питания, включая бесплодие, иммунную дисрегуляцию, ускоренное старение, дисрегуляцию генов, связанных с синтезом холестерина, инсулиновым регулированием, клеточной сигнализацией и формированием белков, а также изменения печени, почек, селезенки и желудочно-кишечного тракта».
    Документ, определяющий позицию AAEM о генетически модифицированных продуктах питания, можно найти на http://www.aaemonline.org

  125. «Ученые выяснили — самый известный препарат против сорняков, устойчивостью к которому обладают большинство трансгенных растений, приводит к гибели клеток эмбрионов, клеток пуповинной крови и плаценты человека, а различные его составы фактически не изучены.
    Как стало известно Biosafety.ru, ученые впервые исследовали механизмы токсического действия четырех различных составов гербицида Раундап, используя для этого человеческие клетки. Специалисты Университета г.Каена во Франции Нора Бенакур (Nora Benachour) и профессор Жиль-Эрик Сералини (Gilles-Eric Séralini) опубликовали результаты своей работы в американском научном журнале Chemical Research in Toxicology 23 декабря 2008 года в статье «Glyphosate Formulations Induce Apoptosis and Necrosis in Human Umbilical, Embryonic, and Placental Cells».
    Они в частности отобрали для исследования клетки пуповинной крови новорожденных и определили воздействие на них минимальной дозы состава гербицида раундап (раствор 1 к 100 тысячам и более), это такая пропорция, в которой этот состав уже не является гербицидом. Через несколько часов обнаружилось, что клетки запрограммированы на смерть. Также были выявлены разрушения мембраны и ДНК. Выяснилось, что раундап препятствует клеточному дыханию. Кроме того, утверждают исследователи, смесь вспомогательных веществ, входящих в состав раундапа, усиливает действие основного вещества гербицида – глифосата, при этом один из его метаболитов может оказаться еще более токсичным… »
    Вот тебе на…

  126. Re: Дураки они, что ли?
    Об AAEM и другие questionable health practices можно знайти тут http://www.quackwatch.com/04ConsumerEducation/nonrecorg.html

  127. И что? Разве кто-то утверждал, что раундап полезен? ГМО позволяют редуцировать его использование.

  128. Очень жаль.
    Вы не смотрели ролик?
    А как думаете, какие прибыли получают американские компании производя гербициды и прочие ядохимикаты?
    Я работал на заводах по производству фазалона, катарана, акрекса.
    Вам эти слова знакомы?
    Вы видели людей, работающих на этих заводах?
    Если не очень понятно, повторю. ГМО выводят устойчивыми к ядохимикатам. Что позволяет более широко их использовать. Ядохимикаты с растениями попадают в организм человека, употребляющего ГМО.
    Для справки. Фазалон. Аналог вещества, который американцы применяли во Вьетнаме во время войны.

  129. Re: Очень жаль.
    В этом журнале есть ответы на все ваши вопросы. Достаточно нажать на тег gmo.

  130. За совет съесть экспериментальный помидор с невыясненными свойствами надо в тюрьму сажать.
    Отвечая на ваш вопрос… Представьте результаты многолетних исследований групп добровольцев, желательно в нескольких поколениях с доказательствами безопасности употребления ГМО непойми чего и мы(потребители) возможно станем это есть.

  131. Хорошо. Но вы, потребители, сейчас бегом в тайгу, на лишайники и воду. Подождите там пару поколений, пока мы тут протестируем. Я вам серьезно говорю. Вы сейчас все едите то, что никто не проверял на добровольцах много поколений. Зачем вам такой риск?

Добавить комментарий

Заполните поля или щелкните по значку, чтобы оставить свой комментарий:

Логотип WordPress.com

Для комментария используется ваша учётная запись WordPress.com. Выход /  Изменить )

Google+ photo

Для комментария используется ваша учётная запись Google+. Выход /  Изменить )

Фотография Twitter

Для комментария используется ваша учётная запись Twitter. Выход /  Изменить )

Фотография Facebook

Для комментария используется ваша учётная запись Facebook. Выход /  Изменить )


Connecting to %s

%d такие блоггеры, как: